NATURAL AND AGRICULTURAL SCIENCES 2.0. Materials and methods 2.1. Synthesis and characterization of SiO @Zn2+ 2 2+ Incorporation of Zn cation onto SiO was achieved according to the procedure or method described in literature with 2 slight modifications (Chen et al., 2020). 2 g of cetyltrimethylammonium bromide (CTAB) and 4 mL of NaOH were dissolved o into 50 mL deionized water. The solution was stirred on the mantle for 1h at 70 C. 5 mL of tetraothorsilicate (TEOS) and nitric acid (HNO o 3) was added after a minute. The solution was further stirred for 30 minutes at 60 C. Then, 0.02 M of zinc nitrate (N O Zn.6H 0) was added in the ratio 1:1 of Zn:TEOS. All particles were further stirred for 2 h before being 2 6 2 separated and centrifuge. Then, the particles were washed three times with distilled water and dried overnight in an oven o o at 50 C. The cation-containing particles were calcined at 550 C for 18 h to remove the remaining CTAB and nitrite. The surface morphology and elemental compositions were achieved using scanning electron microscope (SEM) coupled with energy dispersive x-ray spectroscope (EDX) (JOEL JSM-6390LVSEM), respectively. 2.2. Extraction and molecular characterization of bacterial DNA The antibiotic-resistant Listeria monocytogene bacteria used in this study were obtained from our laboratory archives isolated from food and vegetables. Before the commencement of genomic DNA extraction, the bacteria isolate was subjected to an antibiotic susceptible test (Humphries et al., 2021). The extraction was carried out according to the method described in literature (Ribeiro et al., 2016). The test for antibiotic resistance genes was conducted using the primers and PCR conditions of the targeted resistance gene shown in Table 1. Table 1: Primer sequence, expected product size, and PCR protocol used for the amplification of resistance genes. Antibiotic PCR Primer sequences Product PCR protocols References Class primers size (bp) Tetracyclines tetA F: GCTACATCCTGCTTGCCTTC 210 94 °C – 5 min; 35[94 °C – 1 min; 55 °C – (Titilawo et R: CATAGATCGCCGTGAAGAGG 1 min; 72 °C 1½ min]; 72 °C – 5 min. al., 2015) 2.3. Batch adsorption study Bacterial DNA (2 mL) was used to contaminate nuclease-free water (NFW). 20 mg of SiO @Zn2+ as adsorbent was weighed 2 and added to the prepared contaminated NFW for the batch adsorption study according to the method described in literature (Ezeuko et al., 2022). Effect of contact time (0-80 mins), initial DNA concentrations (7.28 µg/mL), and adsorbent dose (10-30 mg) on DNA removal were investigated. The optimum parameters were determined and adopted during the experimentation. The percentage removal efficiency (%R) in all the solutions was calculated using Equation (1) described by (Panahi et al., 2019). Where C and C are the initial and final concentrations of DNA i f measured in µg/mL, and % R is the removal efficiency. 3.0. Result and discussion 3.1. Antibiotic susceptibility test (AST)/molecular characterization of genomic DNA The AST test showed that Listeria monocytogenes (bacteria isolates) were resistant to sulfamethoxazole, erythromycin, streptomycin, amoxicillin, and tetracycline. The determination of resistance genes was achieved by visualizing the PCR product amplifications containing genomic DNA using gel electrophoresis, indicating that bacteria isolates habors tetA resistance genes at the molecular weight of 210 bp (Figure 1) Figure 1. Gel representing tetracycline resistant gene (tetA) amplified Research Report 2021/2022 | 22